Stem-loop sequence ghr-MIR156d

Accession MI0005641
Description Gossypium hirsutum miR156d stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gag     u           -           - a      uu     aa 
   agguu gacagaagaga gugagcacacg c ggcaga  guaug  a
   ||||| ||||||||||| ||||||||||| | ||||||  |||||   
   uucga cugucuucucu cacucgugugc g ccguuu  cauac  g
--a     -           u           c c      -c     cg 
Get sequence

Mature sequence ghr-miR156d

Accession MIMAT0005809
Sequence

9 - 

ugacagaagagagugagcac

 - 28

Get sequence
Evidence by similarity; MI0002189

References

1
PMID:18603441 "Identification of micro-RNAs in cotton" Khan Barozai MY, Irfan M, Yousaf R, Ali I, Qaisar U, Maqbool A, Zahoor M, Rashid B, Hussnain T, Riazuddin S Plant Physiol Biochem. 46:739-751(2008).