Dead miRNA entry

miRNA accession:
MI0005635
miRNA ID:
mtr-MIR171g
Forward to:
MI0005619
Comment:
Two MIR171 sequences map to the same locus in the Mt3.5.2 genome assembly, so are merged in miRBase 20.

Previous miRNA entry

Stem-loop sequence mtr-MIR171g

AccessionMI0005635 (change log)
DescriptionMedicago truncatula miR171g stem-loop
Stem-loop
   aa            c       c       aagugau       -    a   ag 
5'   ugagauauuggc ugguuca ucagacc       aaaccac uaag uac  u
     |||||||||||| ||||||| |||||||       ||||||| |||| |||   
3'   acucuauaaccg gccgagu aguuugg       uuuggug guuc aug  a
   uc            u       u       -----gu       u    -   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 31404873-31405008 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR171g
mtr-MIR171gchr3: 31404873-31405008 [-]
mtr-MIR171hchr3: 31404708-31404816 [-]
Database links

Mature sequence mtr-miR171g

Accession MIMAT0011121
Sequence

80 - 

uugauugagccgugccaauau

 - 100

Get sequence
Evidence experimental;