Stem-loop sequence mtr-MIR396b

AccessionMI0005622 (change log)
DescriptionMedicago truncatula miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention mtr-MIR396b
(8 sentences)

Stem-loop
      uc            c          -uc   auugaguuccuuu 
5' uau  uuccacagcuuu uugaacugca   caa             g
   |||  |||||||||||| ||||||||||   |||              
3' aua  agggugucgaaa aacuuggcgu   guu             c
      ga            u          uuu   accgguaccguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 39798253-39798347 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR396b
mtr-MIR396bchr4: 39798253-39798347 [-]
mtr-MIR396achr4: 39789612-39789704 [+]
Database links

Mature sequence mtr-miR396b-5p

Accession MIMAT0011108
Sequence

6 - 

uuccacagcuuucuugaacug

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR396b-3p

Accession MIMAT0026732
Sequence

72 - 

guucaauaaagcugugggaag

 - 92

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).