Stem-loop sequence mtr-MIR166g

AccessionMI0005618 (change log)
DescriptionMedicago truncatula miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention mtr-MIR166g
(40 sentences)

Stem-loop
   u   a        uu      cu      cg    cuucu       ---a    a 
5'  uug ggggaaug  gucugg  cgagga  cuuu     cgaucua    ugca a
    ||| ||||||||  ||||||  ||||||  ||||     |||||||    ||||  
3'  aac ccccuuac  cggacc  gcucuu  gaaa     guuaggu    gugu u
   u   c        uu      ag      au    ----u       acug    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 6508264-6508370 [-]
intergenic
Database links

Mature sequence mtr-miR166g-5p

Accession MIMAT0026730
Sequence

8 - 

ggaauguugucuggcucgagg

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR166g-3p

Accession MIMAT0011104
Sequence

82 - 

ucggaccaggcuucauucccc

 - 102

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).