Stem-loop sequence mtr-MIR160d

AccessionMI0005615 (change log)
DescriptionMedicago truncatula miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

5 open access papers mention mtr-MIR160d
(16 sentences)

Stem-loop
   -        c       cu          ug a    c      g 
5'  uagugugc uggcucc  guaugccauu  u gagu caucac a
    |||||||| |||||||  ||||||||||  | |||| ||||||  
3'  gucguacg acugagg  caugcgguaa  g uuca guagug c
   u        u       cu          gu a    a      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 32017510-32017600 [-]
intergenic
Database links

Mature sequence mtr-miR160d

Accession MIMAT0011101
Sequence

6 - 

ugccuggcucccuguaugcca

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).