Stem-loop sequence mtr-MIR166f

AccessionMI0005614 (change log)
DescriptionMedicago truncatula miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention mtr-MIR166f
(40 sentences)

Stem-loop
   --   uu             u   a       cacaca   -      uucu    uuu  -a    -u      uaauuuauguucauacauc 
5'   ugu  ggaaugagguuug ucc agaucau      uca uguuuc    uccc   ca  uaau  cuugau                   u
     |||  ||||||||||||| ||| |||||||      ||| ||||||    ||||   ||  ||||  ||||||                   a
3'   aca  ccuuacuucggac agg ucuagug      agu auagag    aggg   gu  auua  gaacua                   u
   cc   cu             c   c       ----ag   u      ---u    uac  ac    cu      uuauauauaucuauauaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 26018024-26018202 [-]
intergenic
Database links

Mature sequence mtr-miR166f

Accession MIMAT0011100
Sequence

154 - 

ucggaccaggcuucauuccuc

 - 174

Get sequence
Evidence experimental; Illumina [2-3]

References

1
" Bonnet E Unpublished (2007).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).