miRNA Entry for MI0005610

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

mir-399 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-399
Identifiers
Symbol	mir-399
Rfam	RF00445
miRBase	MI0001020
miRBase family	MIPF0000015
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter.^[1] The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

[edit] References

^ Jones-Rhoades, MW; Bartel DP (2004). "Computational Identification of Plant MicroRNAs and Their Targets, Including a Stress-Induced miRNA". Mol Cell 14 (6): 787–799. doi:10.1016/j.molcel.2004.05.027. PMID 15200956.

[edit] Further reading

Franco-Zorrilla JM, Valli A, Todesco M, et al. (August 2007). "Target mimicry provides a new mechanism for regulation of microRNA activity". Nat. Genet. 39 (8): 1033–7. doi:10.1038/ng2079. PMID 17643101.

[edit] External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

Mature sequence mtr-miR399o
Accession	MIMAT0011096
Sequence	67 - ugccaaaggagagcugcccug - 87 Get sequence
Evidence	by similarity; MI0001020
Validated targets	TARBASE:mtr-miR399o

References
1	" Bonnet E Unpublished (2007).

miRBase

Stem-loop sequence mtr-MIR399o

[edit] References

[edit] Further reading

[edit] External links

Mature sequence mtr-miR399o

References