Stem-loop sequence mtr-MIR399m

AccessionMI0005608 (change log)
DescriptionMedicago truncatula miR399m stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399m
(25 sentences)

Stem-loop
   ag          ug     a           ---ua   u au 
5'   ucauagggca  ucucu uuggcagguga     uag g  a
     ||||||||||  ||||| |||||||||||     ||| |   
3'   aguaucccgu  agagg aaccguucacu     auc c  u
   ua          cg     a           uaaag   u gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 21530943-21531027 [-]
intergenic
chr6: 21570754-21570838 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399m
mtr-MIR399mchr6: 21570754-21570838 [-]
mtr-MIR399mchr6: 21530943-21531027 [-]
mtr-MIR2652ichr6: 21529035-21529269 [+]
Database links

Mature sequence mtr-miR399m

Accession MIMAT0011094
Sequence

60 - 

ugccaaaggagagcugcccua

 - 80

Get sequence
Evidence by similarity; MI0001020

References

1
" Bonnet E Unpublished (2007).