Stem-loop sequence mtr-MIR156g

AccessionMI0005607
DescriptionMedicago truncatula miR156g stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      u u         -a          u     ugauaugcauacacauauauauacaac 
5' ggu g ugacagaag  uagagggcac aagga                           a
   ||| | |||||||||  |||||||||| |||||                            
3' cca c acugucuuc  aucucucgug uuccu                           u
      - u         ag          u     uuacuuuacguuaauucgaggaggagg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 18847298-18847417 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR156g
mtr-MIR156gchr6: 18847298-18847417 [-]
mtr-MIR2630qchr6: 18839111-18839338 [-]

Mature sequence mtr-miR156g-5p

Accession MIMAT0011093
Sequence

6 - 

uugacagaagauagagggcac

 - 26

Get sequence
Evidence experimental; Illumina [2]
Validated targets

Mature sequence mtr-miR156g-3p

Accession MIMAT0026728
Sequence

97 - 

gcucucuagacuucugucauc

 - 117

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).