Stem-loop sequence mtr-MIR393b

AccessionMI0005601 (change log)
DescriptionMedicago truncatula miR393b stem-loop
Gene family MIPF0000083; MIR393
Literature search

4 open access papers mention mtr-MIR393b
(8 sentences)

Stem-loop
   -a  c            c    u          cuaauuaagucccuagcuacuuaauua 
5'   gg auccaaagggau gcau gaucccaaau                           a
     || |||||||||||| |||| ||||||||||                            
3'   cu uagguuucccua cgua cuaggguuua                           c
   ua  -            u    -          uaauacucuauaauuccuuuaauucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 33945918-33946036 [+]
intergenic
Database links

Mature sequence mtr-miR393b-5p

Accession MIMAT0011087
Previous IDsmtr-miR393b
Sequence

6 - 

uccaaagggaucgcauugauc

 - 26

Get sequence
Evidence experimental; Northern [2]

Mature sequence mtr-miR393b-3p

Accession MIMAT0022936
Sequence

90 - 

uuugggaucaugcuaucccuu

 - 110

Get sequence
Evidence experimental; Illumina [3]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).