Stem-loop sequence mtr-MIR398a

AccessionMI0005599 (change log)
DescriptionMedicago truncatula miR398a stem-loop
Gene family MIPF0000107; MIR398
Literature search

4 open access papers mention mtr-MIR398a
(10 sentences)

Stem-loop
   u        a     a               ug    aucau     gu 
5'  cucagagg gugac cugagaacacaagau  auua     auaau  a
    |||||||| ||||| |||||||||||||||  ||||     |||||  u
3'  gaguuucc cacug gacucuuguguuuua  ugau     uguug  u
   u        c     -               gu    --cau     gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 18765673-18765770 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR398a
mtr-MIR398achr5: 18765673-18765770 [-]
mtr-MIR2119chr5: 18765366-18765495 [-]
Database links

Mature sequence mtr-miR398a-5p

Accession MIMAT0022935
Sequence

8 - 

ggagugacacugagaacacaag

 - 29

Get sequence
Evidence experimental; Illumina [3]

Mature sequence mtr-miR398a-3p

Accession MIMAT0011085
Previous IDsmtr-miR398a
Sequence

73 - 

uguguucucaggucaccccuu

 - 93

Get sequence
Evidence experimental; Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).