Stem-loop sequence mtr-MIR166e

AccessionMI0005594 (change log)
DescriptionMedicago truncatula miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention mtr-MIR166e
(40 sentences)

Stem-loop
   u            uu g    cu         uc     -c    agg   uu 
5'  uugaggggaaug  g cugg  cgaggcuuu  aguuu  acaa   aag  c
    ||||||||||||  | ||||  |||||||||  |||||  ||||   |||   
3'  aacuccccuuac  c gacc  gcuucggaa  ucaag  uguu   uuc  a
   a            uu g    ag         ua     ua    -aa   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 27465367-27465472 [-]
intergenic
Database links

Mature sequence mtr-miR166e-5p

Accession MIMAT0026726
Sequence

8 - 

ggaauguuggcuggcucgagg

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR166e-3p

Accession MIMAT0011080
Sequence

81 - 

ucggaccaggcuucauucccc

 - 101

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).