Stem-loop sequence mtr-MIR399k

AccessionMI0005592 (change log)
DescriptionMedicago truncatula miR399k stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399k
(22 sentences)

Stem-loop
       a     g      cu         -g       -  uagagag 
5' aaug uaggg aaaucu  uuuggcaga  aggagua gc       c
   |||| ||||| ||||||  |||||||||  ||||||| ||        
3' uuac guccc uuuaga  aaaccguuu  ucuucgu cg       u
       c     g      ag         ga       u  uacaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 24004937-24005030 [-]
intergenic
chr8: 24176682-24176775 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399k
mtr-MIR399cchr8: 24182595-24182713 [-]
mtr-MIR5246chr8: 24180980-24181049 [-]
mtr-MIR399kchr8: 24176682-24176775 [-]
mtr-MIR399jchr8: 24173628-24173718 [+]
mtr-MIR399hchr8: 24167198-24167287 [-]
mtr-MIR399hchr8: 24050903-24050992 [+]
mtr-MIR399rchr8: 24012653-24012754 [+]
mtr-MIR399cchr8: 24010865-24010983 [-]
mtr-MIR5246chr8: 24009245-24009314 [-]
mtr-MIR399kchr8: 24004937-24005030 [-]
mtr-MIR399jchr8: 24001880-24001970 [+]
mtr-MIR399hchr8: 24000209-24000298 [-]
mtr-MIR399hchr8: 23153129-23153218 [+]
Database links

Mature sequence mtr-miR399k

Accession MIMAT0011078
Sequence

69 - 

ugccaaagaagauuugcccug

 - 89

Get sequence
Evidence by similarity; MI0001802

References

1
" Bonnet E Unpublished (2007).