Stem-loop sequence mtr-MIR399j

Accession MI0005591
Description Medicago truncatula miR399j stem-loop
Gene family MIPF0000015; MIR399
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--uuacu      uga          a  -    gac   -     u 
       gggcaa   cuucuuuggc gu aguu   uug aucau c
       ||||||   |||||||||| || ||||   ||| |||||  
       cccguu   gaagaaaccg ca ucaa   aac uagua a
uuaacgc      -ua          c  c    aca   g     g 
Get sequence
Genome context
Coordinates (Mt3.0) Overlapping transcripts
MtChr4: 32745963-32746053 [+]
intergenic
MtChr4: 32915241-32915331 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399j
mtr-MIR399g MtChr4: 31901726-31901829 [-]
mtr-MIR399g MtChr4: 32738600-32738703 [+]
mtr-MIR399j MtChr4: 32745963-32746053 [+]
mtr-MIR399k MtChr4: 32749020-32749113 [-]
mtr-MIR5246 MtChr4: 32753336-32753405 [-]
mtr-MIR399c MtChr4: 32754956-32755074 [-]
mtr-MIR399g MtChr4: 32903128-32903231 [+]
mtr-MIR399j MtChr4: 32915241-32915331 [+]
mtr-MIR399k MtChr4: 32918295-32918388 [-]
mtr-MIR5246 MtChr4: 32922593-32922662 [-]
mtr-MIR399c MtChr4: 32924208-32924326 [-]
mtr-MIR399g MtChr4: 32972167-32972270 [+]

Mature sequence mtr-miR399j

Accession MIMAT0011077
Sequence

66 - 

cgccaaagaagauuugccccg

 - 86

Get sequence
Evidence by similarity; MI0001023
Validated targets

References

1
" Bonnet E Unpublished (2007).