Stem-loop sequence mtr-MIR399j

AccessionMI0005591 (change log)
DescriptionMedicago truncatula miR399j stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399j
(22 sentences)

Stem-loop
   --uuacu      uga          a  -    gac   -     u 
5'        gggcaa   cuucuuuggc gu aguu   uug aucau c
          ||||||   |||||||||| || ||||   ||| |||||  
3'        cccguu   gaagaaaccg ca ucaa   aac uagua a
   uuaacgc      -ua          c  c    aca   g     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 24001880-24001970 [+]
intergenic
chr8: 24173628-24173718 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399j
mtr-MIR399hchr8: 23153129-23153218 [+]
mtr-MIR399gchr8: 23158805-23158908 [-]
mtr-MIR399gchr8: 23994507-23994610 [+]
mtr-MIR399hchr8: 24000209-24000298 [-]
mtr-MIR399jchr8: 24001880-24001970 [+]
mtr-MIR399kchr8: 24004937-24005030 [-]
mtr-MIR5246chr8: 24009245-24009314 [-]
mtr-MIR399cchr8: 24010865-24010983 [-]
mtr-MIR399hchr8: 24050903-24050992 [+]
mtr-MIR399gchr8: 24161515-24161618 [+]
mtr-MIR399hchr8: 24167198-24167287 [-]
mtr-MIR399jchr8: 24173628-24173718 [+]
mtr-MIR399kchr8: 24176682-24176775 [-]
mtr-MIR5246chr8: 24180980-24181049 [-]
mtr-MIR399cchr8: 24182595-24182713 [-]
mtr-MIR399gchr8: 24230599-24230702 [+]
Database links

Mature sequence mtr-miR399j

Accession MIMAT0011077
Sequence

66 - 

cgccaaagaagauuugccccg

 - 86

Get sequence
Evidence by similarity; MI0001023

References

1
" Bonnet E Unpublished (2007).