Stem-loop sequence mtr-MIR399i

AccessionMI0005590 (change log)
DescriptionMedicago truncatula miR399i stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399i
(22 sentences)

Stem-loop
       a   a          a  a     -ac      gaaa  uug 
5' aaug uag gcaaaucucu uu gcaga   gaagua    gc   g
   |||| ||| |||||||||| || |||||   ||||||    ||    
3' uuac guc cguuuagagg aa cguuu   cuucgu    cg   a
       c   c          a  c     ggu      ---a  uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 24171964-24172053 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399i
mtr-MIR5246chr8: 24180980-24181049 [-]
mtr-MIR399kchr8: 24176682-24176775 [-]
mtr-MIR399jchr8: 24173628-24173718 [+]
mtr-MIR399ichr8: 24171964-24172053 [-]
mtr-MIR399hchr8: 24167198-24167287 [-]
mtr-MIR399hchr8: 24050903-24050992 [+]
mtr-MIR5246chr8: 24009245-24009314 [-]
mtr-MIR399kchr8: 24004937-24005030 [-]
mtr-MIR399jchr8: 24001880-24001970 [+]
mtr-MIR399hchr8: 24000209-24000298 [-]
mtr-MIR399hchr8: 23153129-23153218 [+]
Database links

Mature sequence mtr-miR399i

Accession MIMAT0011076
Sequence

65 - 

ugccaaaggagauuugcccug

 - 85

Get sequence
Evidence by similarity; MI0001023

References

1
" Bonnet E Unpublished (2007).