Stem-loop sequence mtr-MIR399h

AccessionMI0005589 (change log)
DescriptionMedicago truncatula miR399h stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399h
(25 sentences)

Stem-loop
       a   a          a        -ac      gaaa  uug 
5' aaug uag gcaaaucucu uuggcaga   gaagua    gc   g
   |||| ||| |||||||||| ||||||||   ||||||    ||    
3' uuac guc cguuuagagg aaccguuu   cuucgu    cg   a
       c   c          a        ggu      ---a  uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 23153129-23153218 [+]
intergenic
chr8: 24000209-24000298 [-]
intergenic
chr8: 24050903-24050992 [+]
intergenic
chr8: 24167198-24167287 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399h
mtr-MIR399hchr8: 23153129-23153218 [+]
mtr-MIR399gchr8: 23158805-23158908 [-]
mtr-MIR399gchr8: 23994507-23994610 [+]
mtr-MIR399hchr8: 24000209-24000298 [-]
mtr-MIR399hchr8: 24050903-24050992 [+]
mtr-MIR399gchr8: 24161515-24161618 [+]
mtr-MIR399hchr8: 24167198-24167287 [-]
mtr-MIR399gchr8: 24230599-24230702 [+]
Database links

Mature sequence mtr-miR399h

Accession MIMAT0011075
Sequence

65 - 

ugccaaaggagauuugcccug

 - 85

Get sequence
Evidence by similarity; MI0001020

References

1
" Bonnet E Unpublished (2007).