Stem-loop sequence mtr-MIR399f

AccessionMI0005587 (change log)
DescriptionMedicago truncatula miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399f
(22 sentences)

Stem-loop
   --uuaca   ug   u    a         a  uagu     ---u    ua     
5'        ggg  agu cucc uuggcaggu gc    cacua    auga  ugca 
          |||  ||| |||| ||||||||| ||    |||||    ||||  ||| u
3'        ccc  uua gagg aaccgucua cg    gugau    uacu  acgu 
   uuagcga   gu   -    a         a  ---u     ucuc    ua     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 23166508-23166611 [-]
intergenic
chr8: 23986801-23986904 [+]
intergenic
chr8: 24153821-24153924 [+]
intergenic
chr8: 24222878-24222981 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399f
mtr-MIR399gchr8: 24230599-24230702 [+]
mtr-MIR399fchr8: 24222878-24222981 [+]
mtr-MIR399echr8: 24214214-24214347 [+]
mtr-MIR399gchr8: 24161515-24161618 [+]
mtr-MIR399fchr8: 24153821-24153924 [+]
mtr-MIR399echr8: 24145178-24145311 [+]
mtr-MIR399gchr8: 23994507-23994610 [+]
mtr-MIR399fchr8: 23986801-23986904 [+]
mtr-MIR399echr8: 23978156-23978289 [+]
mtr-MIR399echr8: 23175117-23175250 [-]
mtr-MIR399fchr8: 23166508-23166611 [-]
mtr-MIR399achr8: 23163782-23163915 [-]
mtr-MIR399gchr8: 23158805-23158908 [-]
Database links

Mature sequence mtr-miR399f

Accession MIMAT0011073
Sequence

79 - 

ugccaaaggagauuugcccag

 - 99

Get sequence
Evidence by similarity; MI0001020

References

1
" Bonnet E Unpublished (2007).