Stem-loop sequence mtr-MIR166d

AccessionMI0005582 (change log)
DescriptionMedicago truncatula miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention mtr-MIR166d
(40 sentences)

Stem-loop
   g        a   uu         a       --       uu  u 
5'  uugagggg aug  gccuggcuc aggcuuu  ucauagu  ga c
    |||||||| |||  ||||||||| |||||||  |||||||  ||  
3'  aacucccc uac  cggaccggg uucggaa  aguauca  cu u
   a        c   uu         c       uu       -u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 33642148-33642238 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR166d
mtr-MIR166dchr3: 33642148-33642238 [-]
mtr-MIR166cchr3: 33641974-33642078 [-]
Database links

Mature sequence mtr-miR166d

Accession MIMAT0011068
Sequence

66 - 

ucgggccaggcuucauccccc

 - 86

Get sequence
Evidence by similarity; MI0000199

References

1
" Bonnet E Unpublished (2007).