Stem-loop sequence mtr-MIR166c

AccessionMI0005581 (change log)
DescriptionMedicago truncatula miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention mtr-MIR166c
(40 sentences)

Stem-loop
   gc  a      c c       cu      augcucagaucuguuuugaucu 
5'   ug gaggaa g agucugg  cgagga                      g
     || |||||| | |||||||  ||||||                      a
3'   ac cuccuu c ucggacc  gcucuu                      u
   cu  c      a u       ag      aauuaaucuauacuuguauagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 33641974-33642078 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR166c
mtr-MIR166dchr3: 33642148-33642238 [-]
mtr-MIR166cchr3: 33641974-33642078 [-]
Database links

Mature sequence mtr-miR166c

Accession MIMAT0011067
Sequence

80 - 

ucggaccaggcuucauuccuc

 - 100

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).