Stem-loop sequence mtr-MIR160c

AccessionMI0005576 (change log)
DescriptionMedicago truncatula miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

5 open access papers mention mtr-MIR160c
(16 sentences)

Stem-loop
   -uc      c         ga      uc  ag   c       a 
5'    gcuugc uggcucccu  augcca  ug  aag uugucaa a
      |||||| |||||||||  ||||||  ||  ||| ||||||| c
3'    cggacg accgaggga  uacggu  ac  uuc aacgguu g
   cgu      u         ag      uu  cu   c       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 9007365-9007456 [-]
intergenic
Database links

Mature sequence mtr-miR160c

Accession MIMAT0011062
Sequence

6 - 

ugccuggcucccugaaugcca

 - 26

Get sequence
Evidence by similarity; MI0001101

References

1
" Bonnet E Unpublished (2007).