Stem-loop sequence mtr-MIR166b

AccessionMI0005575 (change log)
DescriptionMedicago truncatula miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

10 open access papers mention mtr-MIR166b
(44 sentences)

Stem-loop
       a        uu      cu         aacua  -    uu  uuug        a    uu   u      cu          
5' guug ugggaaug  guuugg  cgagguaau     ac ucaa  uc    ucuuugaa gcuu  cuu guuuca  cuuuuugau 
   |||| ||||||||  ||||||  |||||||||     || ||||  ||    |||||||| ||||  ||| ||||||  |||||||| u
3' caac auccuuac  cggacc  gcucuauua     ug aguu  ag    ggaaauuu cgag  gaa caaagu  gaaagauuc 
       c        uu      ag         --gug  u    uu  -uuu        -    -u   u      -u          
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 950526-950695 [-]
intergenic
Database links

Mature sequence mtr-miR166b

Accession MIMAT0011061
Sequence

145 - 

ucggaccaggcuucauuccua

 - 165

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).