Stem-loop sequence mtr-MIR160b

AccessionMI0005574 (change log)
DescriptionMedicago truncatula miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

5 open access papers mention mtr-MIR160b
(16 sentences)

Stem-loop
   -gu      c       cu         a  ug   c       a 
5'    augugc uggcucc  guaugccau ua  aag ucauuga a
      |||||| |||||||  ||||||||| ||  ||| |||||||  
3'    uauacg accgagg  uaugcggua gu  uuc aguaacu a
   ccu      a       ag         g  gu   c       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 27239019-27239109 [+]
intergenic
Database links

Mature sequence mtr-miR160b

Accession MIMAT0011060
Sequence

6 - 

ugccuggcucccuguaugcca

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).