Stem-loop sequence mtr-MIR167a

AccessionMI0005572 (change log)
Previous IDsmtr-MIR167
DescriptionMedicago truncatula miR167 stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention mtr-MIR167a
(13 sentences)

Stem-loop
   -aaa     a   -  -             guuu      acaa           ---agaa   acua    -  u  u         a             gauuacucucuuucacaaaauagguauuaaagugccaugauuuuugcauuacuaaugggaaa 
5'     aguga gcu gc cagcaugaucuag    gguuau    uaguaguauug       gga    uaua cg uu uuuuuuacu uaccacaaaaaaa                                                              a
       ||||| ||| || |||||||||||||    ||||||    |||||||||||       |||    |||| || || ||||||||| |||||||||||||                                                              u
3'     ucacu cga cg gucguacuggauc    ccaaua    aucgucaugau       ccu    auau gc ga aaaaaauga augguguuuuuuu                                                              a
   uucc     c   u  u             aguc      --cg           gaacaua   ----    c  c  u         c             auggugguuuuggauaaaggauagauauauuuuuuuuucacucuuuaagccacagguuuuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 17502130-17502449 [-]
intergenic
Database links

Mature sequence mtr-miR167a

Accession MIMAT0011058
Previous IDsmtr-miR167
Sequence

6 - 

ugaagcugccagcaugaucua

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).