Stem-loop sequence hsa-mir-208b

Accession MI0005570
Symbol HGNC:MIR208B
Description Homo sapiens miR-208b stem-loop
Gene family MIPF0000178; mir-208
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-208. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-208 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. In humans, the gene for miR-208 is located in an intron of MYH7.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--c        g          c   aa        cu 
   cucucagg aagcuuuuug ucg  uuauguuu  g
   |||||||| |||||||||| |||  ||||||||  a
   gggagucu uuuggaaaac agc  aauauaag  u
gac        g          a   ag        cc 
Get sequence
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 23887196-23887272 [-]
sense
OTTHUMT00000071798 ; MYH7-001; intron 30
OTTHUMT00000071798 ; MYH7-001; intron 30
OTTHUMT00000071798 ; MYH7-001; intron 30
ENST00000355349 ; MYH7-001; intron 30
ENST00000355349 ; MYH7-001; intron 30
ENST00000355349 ; MYH7-001; intron 30
ENST00000544444 ; MYH7-201; intron 31
ENST00000544444 ; MYH7-201; intron 31
Database links

Mature sequence hsa-miR-208b

Accession MIMAT0004960
Sequence

46 - 

auaagacgaacaaaagguuugu

 - 67

Get sequence
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).