Stem-loop sequence hsa-mir-208b

AccessionMI0005570 (change log)
Symbol HGNC:MIR208B
DescriptionHomo sapiens miR-208b stem-loop
Gene family MIPF0000178; mir-208
Literature search

101 open access papers mention hsa-mir-208b
(399 sentences)

Stem-loop
   --c        g          c   aa        cu 
5'    cucucagg aagcuuuuug ucg  uuauguuu  g
      |||||||| |||||||||| |||  ||||||||  a
3'    gggagucu uuuggaaaac agc  aauauaag  u
   gac        g          a   ag        cc 
Get sequence
Deep sequencing
3058 reads, 50 reads per million, 24 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 23417987-23418063 [-]
sense
OTTHUMT00000413504 ; RP11-298I3.5-001; intron 1
OTTHUMT00000413502 ; HAUS4-019; intron 2
OTTHUMT00000413464 ; HAUS4-015; intron 3
OTTHUMT00000413447 ; HAUS4-008; intron 4
OTTHUMT00000071682 ; HAUS4-004; intron 4
OTTHUMT00000071684 ; HAUS4-001; intron 5
OTTHUMT00000413449 ; HAUS4-005; intron 5
OTTHUMT00000071683 ; HAUS4-002; intron 5
OTTHUMT00000413450 ; HAUS4-006; intron 5
OTTHUMT00000413465 ; HAUS4-014; intron 5
OTTHUMT00000413466 ; HAUS4-017; intron 5
OTTHUMT00000071680 ; HAUS4-003; intron 6
OTTHUMT00000413501 ; HAUS4-021; intron 6
OTTHUMT00000413467 ; HAUS4-018; intron 6
OTTHUMT00000413468 ; HAUS4-016; intron 6
ENST00000555074 ; RP11-298I3.5-001; intron 1
ENST00000553794 ; HAUS4-019; intron 2
ENST00000553859 ; HAUS4-015; intron 3
ENST00000554446 ; HAUS4-008; intron 4
ENST00000347758 ; HAUS4-004; intron 4
ENST00000397409 ; HAUS4-201; intron 4
ENST00000490506 ; HAUS4-001; intron 5
ENST00000342454 ; HAUS4-005; intron 5
ENST00000555367 ; HAUS4-002; intron 5
ENST00000555986 ; HAUS4-006; intron 5
ENST00000556915 ; HAUS4-014; intron 5
ENST00000554349 ; HAUS4-017; intron 5
ENST00000206474 ; HAUS4-003; intron 6
ENST00000555040 ; HAUS4-021; intron 6
ENST00000554373 ; HAUS4-018; intron 6
ENST00000554651 ; HAUS4-016; intron 6
ENST00000541587 ; HAUS4-202; intron 6
antisense
OTTHUMT00000408292 ; RP11-298I3.1-001; intron 2
OTTHUMT00000408293 ; RP11-298I3.1-002; intron 2
ENST00000548819 ; RP11-298I3.1-001; intron 2
ENST00000548322 ; RP11-298I3.1-002; intron 2
Database links

Mature sequence hsa-miR-208b-5p

Accession MIMAT0026722
Sequence

11 - 

aagcuuuuugcucgaauuaugu

 - 32

Get sequence
Deep sequencing59 reads, 6 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-208b-3p

Accession MIMAT0004960
Sequence

46 - 

auaagacgaacaaaagguuugu

 - 67

Get sequence
Deep sequencing2991 reads, 22 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).