Stem-loop sequence hsa-mir-216b

AccessionMI0005569 (change log)
Symbol HGNC:MIR216B
DescriptionHomo sapiens miR-216b stem-loop
Gene family MIPF0000054; mir-216
Literature search

57 open access papers mention hsa-mir-216b
(175 sentences)

Stem-loop
   --g       gaa         a  --caaa      g  ac 
5'    cagacug   aaucucugc gg      ugugau uc  u
      |||||||   ||||||||| ||      |||||| ||   
3'    gucugac   uuagagaug cc      acacua ag  g
   aca       auc         c  auucac      a  ga 
Get sequence
Deep sequencing
963 reads, 5.88 reads per million, 85 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 56000714-56000795 [-]
intergenic
Database links

Mature sequence hsa-miR-216b-5p

Accession MIMAT0004959
Sequence

11 - 

aaaucucugcaggcaaauguga

 - 32

Get sequence
Deep sequencing779 reads, 76 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-216b-3p

Accession MIMAT0026721
Sequence

49 - 

acacacuuacccguagagauucua

 - 72

Get sequence
Deep sequencing12 reads, 10 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).