|
miRBase |
|
Stem-loop sequence hsa-mir-216b |
|||||
| Accession | MI0005569 | ||||
| Symbol | HGNC:MIR216B | ||||
| Description | Homo sapiens miR-216b stem-loop | ||||
| Gene family | MIPF0000054; mir-216 | ||||
| Stem-loop |
--g gaa a --caaa g ac cagacug aaucucugc gg ugugau uc u ||||||| ||||||||| || |||||| || gucugac uuagagaug cc acacua ag g aca auc c auucac a ga |
||||
| Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-216b |
|
| Accession | MIMAT0004959 |
| Sequence |
11 - aaaucucugcaggcaaauguga - 32 |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|