Stem-loop sequence hsa-mir-301b

Accession

MI0005568

Symbol

HGNC:MIR301B

Description

Homo sapiens miR-301b stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

---g  g        c      ---g        a  gug u 
    cc caggugcu ugacga    guugcacu cu   c c
    || |||||||| ||||||    |||||||| ||   | u
    gg gucuacga acuguu    uaacguga ga   g g
acca  -        a      auag        c  --a a 

Deep sequencing

305 reads, 22 experiments

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

• Coordinates (GRCh37.p5): chr22: 22007270-22007347 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000102312 ; PPIL2-002; intron 1

  OTTHUMT00000102312 ; PPIL2-002; intron 1

  OTTHUMT00000102312 ; PPIL2-002; intron 1

  ENST00000498589 ; PPIL2-002; intron 1

  ENST00000498589 ; PPIL2-002; intron 1

  ENST00000498589 ; PPIL2-002; intron 1

Clustered miRNAs

< 10kb from hsa-mir-301b

• hsa-mir-301b: chr22: 22007270-22007347 [+]
• hsa-mir-130b: chr22: 22007593-22007674 [+]

Database links

• ENTREZGENE: 100126318;MIR301B
• HGNC: 33667;MIR301B

Mature sequence hsa-miR-301b

• Accession: MIMAT0004958
• Sequence: 45 - cagugcaaugauauugucaaagc - 67
• Deep sequencing: 285 reads, 22 experiments
• Evidence: experimental; cloned [2]
• Validated targets:
  • MIRTARBASE:hsa-miR-301b
  • TARBASE:hsa-miR-301b
• Predicted targets:
  • DIANA-MICROT:hsa-miR-301b
  • MICRORNA.ORG:hsa-miR-301b
  • MIRDB:hsa-miR-301b
  • RNA22-HSA:hsa-miR-301b
  • TARGETMINER:hsa-miR-301b
  • TARGETSCAN-VERT:hsa-miR-301b

References

1. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).