Stem-loop sequence hsa-mir-301b

Accession MI0005568
Symbol HGNC:MIR301B
Description Homo sapiens miR-301b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---g  g        c      ---g        a  gug u 
    cc caggugcu ugacga    guugcacu cu   c c
    || |||||||| ||||||    |||||||| ||   | u
    gg gucuacga acuguu    uaacguga ga   g g
acca  -        a      auag        c  --a a 
Get sequence
Deep sequencing
305 reads, 22 experiments
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr22: 22007270-22007347 [+]
sense
OTTHUMT00000102312 ; PPIL2-002; intron 1
OTTHUMT00000102312 ; PPIL2-002; intron 1
OTTHUMT00000102312 ; PPIL2-002; intron 1
ENST00000498589 ; PPIL2-002; intron 1
ENST00000498589 ; PPIL2-002; intron 1
ENST00000498589 ; PPIL2-002; intron 1
Clustered miRNAs
< 10kb from hsa-mir-301b
hsa-mir-301b chr22: 22007270-22007347 [+]
hsa-mir-130b chr22: 22007593-22007674 [+]
Database links

Mature sequence hsa-miR-301b

Accession MIMAT0004958
Sequence

45 - 

cagugcaaugauauugucaaagc

 - 67

Get sequence
Deep sequencing 285 reads, 22 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).