Stem-loop sequence hsa-mir-301b

AccessionMI0005568
Symbol HGNC:MIR301B
DescriptionHomo sapiens miR-301b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ---g  g        c      ---g        a  gug u 
5'     cc caggugcu ugacga    guugcacu cu   c c
       || |||||||| ||||||    |||||||| ||   | u
3'     gg gucuacga acuguu    uaacguga ga   g g
   acca  -        a      auag        c  --a a 
Get sequence
Deep sequencing
483 reads, 124 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr22: 21652981-21653058 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-301b
hsa-mir-301bchr22: 21652981-21653058 [+]
hsa-mir-130bchr22: 21653304-21653385 [+]
Database links

Mature sequence hsa-miR-301b-5p

Accession MIMAT0032026
Sequence

10 - 

gcucugacgagguugcacuacu

 - 31

Get sequence
Deep sequencing34 reads, 12 experiments
Evidence not experimental

Mature sequence hsa-miR-301b-3p

Accession MIMAT0004958
Previous IDshsa-miR-301b
Sequence

45 - 

cagugcaaugauauugucaaagc

 - 67

Get sequence
Deep sequencing244 reads, 39 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).