Stem-loop sequence hsa-mir-760

AccessionMI0005567
Symbol HGNC:MIR760
DescriptionHomo sapiens miR-760 stem-loop
Gene family MIPF0000395; mir-760
Stem-loop
   --g   cg    c    u   ucca        c    acc 
5'    gcg  ucgc cccc cag    ccagagcc ggau   u
      |||  |||| |||| |||    |||||||| ||||   c
3'    cgu  agcg gggg guc    ggucucgg cuua   a
   caa   aa    a    u   --ug        -    aag 
Get sequence
Deep sequencing
2894 reads, 753 reads per million, 65 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 93846832-93846911 [+]
intergenic
Database links

Mature sequence hsa-miR-760

Accession MIMAT0004957
Sequence

49 - 

cggcucugggucugugggga

 - 68

Get sequence
Deep sequencing703 reads, 24 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).