Stem-loop sequence hsa-mir-374b

AccessionMI0005566
Symbol HGNC:MIR374B
DescriptionHomo sapiens miR-374b stem-loop
Gene family MIPF0000288; mir-374
Stem-loop
   --  u    ug au                     c 
5'   ac cgga  g  auaauacaaccugcuaagugu c
     || ||||  |  |||||||||||||||||||||  
3'   ug gccu  u  uauuauguuggacgauucacg u
   uc  u    gu ac                     a 
Get sequence
Deep sequencing
8321 reads, 1.29e+03 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 74218547-74218618 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-374b
hsa-mir-374cchrX: 74218549-74218618 [+]
hsa-mir-374bchrX: 74218547-74218618 [-]
hsa-mir-421chrX: 74218377-74218461 [-]
Database links

Mature sequence hsa-miR-374b-5p

Accession MIMAT0004955
Previous IDshsa-miR-374b
Sequence

11 - 

auauaauacaaccugcuaagug

 - 32

Get sequence
Deep sequencing788 reads, 54 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-374b-3p

Accession MIMAT0004956
Previous IDshsa-miR-374b*
Sequence

41 - 

cuuagcagguuguauuaucauu

 - 62

Get sequence
Deep sequencing347 reads, 44 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).