Stem-loop sequence hsa-mir-374b

AccessionMI0005566 (change log)
Symbol HGNC:MIR374B
DescriptionHomo sapiens miR-374b stem-loop
Gene family MIPF0000288; mir-374
   --  u    ug au                     c 
5'   ac cgga  g  auaauacaaccugcuaagugu c
     || ||||  |  |||||||||||||||||||||  
3'   ug gccu  u  uauuauguuggacgauucacg u
   uc  u    gu ac                     a 
Get sequence
Deep sequencing
157722 reads, 1.11e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 74218547-74218618 [-]
Clustered miRNAs
< 10kb from hsa-mir-374b
hsa-mir-374cchrX: 74218549-74218618 [+]
hsa-mir-374bchrX: 74218547-74218618 [-]
hsa-mir-421chrX: 74218377-74218461 [-]
Database links

Mature sequence hsa-miR-374b-5p

Accession MIMAT0004955
Previous IDshsa-miR-374b

11 - 


 - 32

Get sequence
Deep sequencing154488 reads, 77 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-374b-3p

Accession MIMAT0004956
Previous IDshsa-miR-374b*

41 - 


 - 62

Get sequence
Deep sequencing3227 reads, 61 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets


PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).