Stem-loop sequence hsa-mir-543

AccessionMI0005565 (change log)
Symbol HGNC:MIR543
DescriptionHomo sapiens miR-543 stem-loop
Gene family MIPF0000110; mir-329
Literature search

25 open access papers mention hsa-mir-543
(50 sentences)

Stem-loop
   --    u  u       u  -     ---u    u    uu 
5'   uacu aa gagaagu gc ccgug    uuuu ucgc  u
     |||| || ||||||| || |||||    |||| ||||  a
3'   auga uu uucuuca cg ggcgc    aaag agug  u
   cu    c  u       -  u     uuac    c    uu 
Get sequence
Deep sequencing
5126 reads, 6.84 reads per million, 117 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression has been independently confirmed in mouse and rat [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101031987-101032064 [+]
antisense
OTTHUMT00000414334 ; BEGAIN-007; intron 1
OTTHUMT00000414329 ; BEGAIN-001; intron 2
OTTHUMT00000414331 ; BEGAIN-005; intron 2
OTTHUMT00000414332 ; BEGAIN-003; intron 2
OTTHUMT00000414335 ; BEGAIN-006; intron 2
OTTHUMT00000414337 ; BEGAIN-004; intron 2
ENST00000557378 ; BEGAIN-007; intron 1
ENST00000443071 ; BEGAIN-201; intron 1
ENST00000355173 ; BEGAIN-001; intron 2
ENST00000553553 ; BEGAIN-005; intron 2
ENST00000556188 ; BEGAIN-003; intron 2
ENST00000554140 ; BEGAIN-006; intron 2
ENST00000554747 ; BEGAIN-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-543
hsa-mir-379chr14: 101022066-101022132 [+]
hsa-mir-411chr14: 101023325-101023420 [+]
hsa-mir-299chr14: 101023794-101023856 [+]
hsa-mir-380chr14: 101025017-101025077 [+]
hsa-mir-1197chr14: 101025564-101025651 [+]
hsa-mir-323achr14: 101025732-101025817 [+]
hsa-mir-758chr14: 101026020-101026107 [+]
hsa-mir-329-1chr14: 101026785-101026864 [+]
hsa-mir-329-2chr14: 101027100-101027183 [+]
hsa-mir-494chr14: 101029634-101029714 [+]
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
Database links

Mature sequence hsa-miR-543

Accession MIMAT0004954
Sequence

47 - 

aaacauucgcggugcacuucuu

 - 68

Get sequence
Deep sequencing5035 reads, 115 experiments
Evidence experimental; RAKE [1]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).