|
miRBase |
|
Stem-loop sequence hsa-mir-873 |
|||||
| Accession | MI0005564 | ||||
| Symbol | HGNC:MIR873 | ||||
| Description | Homo sapiens miR-873 stem-loop | ||||
| Gene family | MIPF0000390; mir-873 | ||||
| Stem-loop |
-- u ca g a ug g a ga gug g uuu c ggaacu u agucuccu uu a ||| | ||| | |||||| | |||||||| || a cac c aag g ccuuga a ucagagga aa a aa c ac g c gu g c gu |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-873-5p |
|
| Accession | MIMAT0004953 |
| Previous IDs | hsa-miR-873 |
| Sequence |
11 - gcaggaacuugugagucuccu - 31 |
| Deep sequencing | 1921 reads, 14 experiments |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-873-3p |
|
| Accession | MIMAT0022717 |
| Sequence |
46 - ggagacugaugaguucccggga - 67 |
| Deep sequencing | 350 reads, 11 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|