Stem-loop sequence hsa-mir-873

AccessionMI0005564 (change log)
Symbol HGNC:MIR873
DescriptionHomo sapiens miR-873 stem-loop
Gene family MIPF0000390; mir-873
Literature search

19 open access papers mention hsa-mir-873
(34 sentences)

Stem-loop
   --   u ca   g a      ug g        a  ga 
5'   gug g  uuu c ggaacu  u agucuccu uu  a
     ||| |  ||| | ||||||  | |||||||| ||  a
3'   cac c  aag g ccuuga  a ucagagga aa  a
   aa   c ac   g c      gu g        c  gu 
Get sequence
Deep sequencing
6010 reads, 8.87 reads per million, 124 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 28888879-28888955 [-]
sense
ENST00000401120 ; MIR873-201; exon 1
Database links

Mature sequence hsa-miR-873-5p

Accession MIMAT0004953
Previous IDshsa-miR-873
Sequence

11 - 

gcaggaacuugugagucuccu

 - 31

Get sequence
Deep sequencing4944 reads, 121 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-873-3p

Accession MIMAT0022717
Sequence

46 - 

ggagacugaugaguucccggga

 - 67

Get sequence
Deep sequencing1065 reads, 55 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).