Stem-loop sequence hsa-mir-887

Accession MI0005562
Symbol HGNC:MIR887
Description Homo sapiens miR-887 stem-loop
Gene family MIPF0000554; mir-887
Stem-loop 
--       u        --  -      ag    ug auu 
  gugcaga ccuuggga  gc ccuguu  acuc  g   u
  ||||||| ||||||||  || ||||||  ||||  |   u
  cacguuu ggagcccu  cg gggcaa  ugag  u   a
ga       c        ac  c      -g    gu cac
Get sequence
Deep sequencing
1365 reads, 25 experiments
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 15935291-15935369 [+]
sense
OTTHUMT00000366117 ; FBXL7-001; intron 3
OTTHUMT00000366118 ; FBXL7-002; intron 3
OTTHUMT00000366117 ; FBXL7-001; intron 3
OTTHUMT00000366118 ; FBXL7-002; intron 3
OTTHUMT00000366117 ; FBXL7-001; intron 3
OTTHUMT00000366118 ; FBXL7-002; intron 3
ENST00000329673 ; FBXL7-201; intron 2
ENST00000329673 ; FBXL7-201; intron 2
ENST00000329673 ; FBXL7-201; intron 2
ENST00000504595 ; FBXL7-001; intron 3
ENST00000510662 ; FBXL7-002; intron 3
ENST00000504595 ; FBXL7-001; intron 3
ENST00000510662 ; FBXL7-002; intron 3
ENST00000504595 ; FBXL7-001; intron 3
ENST00000510662 ; FBXL7-002; intron 3
Database links

Mature sequence hsa-miR-887

Accession MIMAT0004951
Sequence

48 -  

gugaacgggcgccaucccgagg

 - 69

Get sequence
Deep sequencing 1300 reads, 19 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).