Stem-loop sequence hsa-mir-887

AccessionMI0005562 (change log)
Symbol HGNC:MIR887
DescriptionHomo sapiens miR-887 stem-loop
Gene family MIPF0000554; mir-887
Literature search

12 open access papers mention hsa-mir-887
(21 sentences)

Stem-loop
   --       u        --  -      ag    ug auu 
5'   gugcaga ccuuggga  gc ccuguu  acuc  g   u
     ||||||| ||||||||  || ||||||  ||||  |   u
3'   cacguuu ggagcccu  cg gggcaa  ugag  u   a
   ga       c        ac  c      -g    gu cac 
Get sequence
Deep sequencing
18496 reads, 6.62 reads per million, 136 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 15935182-15935260 [+]
sense
OTTHUMT00000366117 ; FBXL7-001; intron 3
OTTHUMT00000366118 ; FBXL7-002; intron 3
ENST00000329673 ; FBXL7-201; intron 2
ENST00000504595 ; FBXL7-001; intron 3
ENST00000510662 ; FBXL7-002; intron 3
Database links

Mature sequence hsa-miR-887-5p

Accession MIMAT0026720
Sequence

10 - 

cuugggagcccuguuagacuc

 - 30

Get sequence
Deep sequencing657 reads, 93 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-887-3p

Accession MIMAT0004951
Sequence

48 - 

gugaacgggcgccaucccgagg

 - 69

Get sequence
Deep sequencing17804 reads, 132 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).