|
miRBase |
|
Stem-loop sequence hsa-mir-877 |
|||||
| Accession | MI0005561 | ||||
| Symbol | HGNC:MIR877 | ||||
| Description | Homo sapiens miR-877 stem-loop | ||||
| Gene family | MIPF0000392; mir-877 | ||||
| Stem-loop |
-gua au c c g caaagac c gaggag gg g aggggacacg g uuggggguu c |||||| || | |||||||||| | ||||||||| u cuccuc cc c ucuccugugu c gacucccag g gacc -- u u g ------a g |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-877-5p |
|
| Accession | MIMAT0004949 |
| Previous IDs | hsa-miR-877 |
| Sequence |
1 - guagaggagauggcgcaggg - 20 |
| Deep sequencing | 3392 reads, 19 experiments |
| Evidence | experimental; cloned [1-3] |
| Predicted targets |
|
Mature sequence hsa-miR-877-3p |
|
| Accession | MIMAT0004950 |
| Previous IDs | hsa-miR-877* |
| Sequence |
66 - uccucuucucccuccucccag - 86 |
| Deep sequencing | 6 reads, 4 experiments |
| Evidence | experimental; cloned [1-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:17964270
"Mammalian mirtron genes"
Mol Cell. 28:328-336(2007).
|