Stem-loop sequence hsa-mir-877

AccessionMI0005561 (change log)
Symbol HGNC:MIR877
DescriptionHomo sapiens miR-877 stem-loop
Gene family MIPF0000392; mir-877
Literature search

31 open access papers mention hsa-mir-877
(61 sentences)

Stem-loop
   -gua      au  c c          g caaagac         c 
5'     gaggag  gg g aggggacacg g       uuggggguu c
       ||||||  || | |||||||||| |       ||||||||| u
3'     cuccuc  cc c ucuccugugu c       gacucccag g
   gacc      --  u u          g ------a         g 
Get sequence
Deep sequencing
14395 reads, 70.3 reads per million, 158 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 30584332-30584417 [+]
antisense
OTTHUMT00000076556 ; PPP1R10-001; 5'UTR (exon 2)
OTTHUMT00000256174 ; PPP1R10-003; exon 2
OTTHUMT00000256173 ; PPP1R10-002; exon 2
ENST00000376511 ; PPP1R10-001; 5'UTR (exon 2)
ENST00000484449 ; PPP1R10-003; exon 2
ENST00000473954 ; PPP1R10-002; exon 2
Database links

Mature sequence hsa-miR-877-5p

Accession MIMAT0004949
Previous IDshsa-miR-877
Sequence

1 - 

guagaggagauggcgcaggg

 - 20

Get sequence
Deep sequencing13921 reads, 149 experiments
Evidence experimental; cloned [1-3]
Database links
Predicted targets

Mature sequence hsa-miR-877-3p

Accession MIMAT0004950
Previous IDshsa-miR-877*
Sequence

66 - 

uccucuucucccuccucccag

 - 86

Get sequence
Deep sequencing424 reads, 69 experiments
Evidence experimental; cloned [1-3]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).