Stem-loop sequence hsa-mir-885

Accession MI0005560
Symbol HGNC:MIR885
Description Homo sapiens miR-885 stem-loop
Gene family MIPF0000532; mir-885
Stem-loop 
--   ca    c           a  -         cu 
  ccg  cucu uccauuacacu cc cugccucuu  c
  |||  |||| ||||||||||| || |||||||||   
  ggc  gaga aggugaugugg gg gacggagag  c
ug   ac    u           -  c         ua
Get sequence
Deep sequencing
35 reads, 9 experiments
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 10436173-10436246 [-]
sense
OTTHUMT00000276087 ; ATP2B2-003; intron 3
OTTHUMT00000276087 ; ATP2B2-003; intron 3
OTTHUMT00000276087 ; ATP2B2-003; intron 3
OTTHUMT00000250576 ; ATP2B2-001; intron 4
OTTHUMT00000250576 ; ATP2B2-001; intron 4
OTTHUMT00000250576 ; ATP2B2-001; intron 4
OTTHUMT00000276086 ; ATP2B2-002; intron 5
OTTHUMT00000276088 ; ATP2B2-004; intron 5
OTTHUMT00000340168 ; ATP2B2-008; intron 5
OTTHUMT00000276086 ; ATP2B2-002; intron 5
OTTHUMT00000276088 ; ATP2B2-004; intron 5
OTTHUMT00000340168 ; ATP2B2-008; intron 5
OTTHUMT00000276086 ; ATP2B2-002; intron 5
OTTHUMT00000276088 ; ATP2B2-004; intron 5
OTTHUMT00000340168 ; ATP2B2-008; intron 5
OTTHUMT00000276089 ; ATP2B2-005; intron 7
OTTHUMT00000276089 ; ATP2B2-005; intron 7
OTTHUMT00000276089 ; ATP2B2-005; intron 7
ENST00000452124 ; ATP2B2-003; intron 3
ENST00000452124 ; ATP2B2-003; intron 3
ENST00000452124 ; ATP2B2-003; intron 3
ENST00000352432 ; ATP2B2-001; intron 4
ENST00000352432 ; ATP2B2-001; intron 4
ENST00000352432 ; ATP2B2-001; intron 4
ENST00000383800 ; ATP2B2-002; intron 5
ENST00000460129 ; ATP2B2-004; intron 5
ENST00000480680 ; ATP2B2-008; intron 5
ENST00000360273 ; ATP2B2-203; intron 5
ENST00000343816 ; ATP2B2-202; intron 5
ENST00000535386 ; ATP2B2-205; intron 5
ENST00000429937 ; ATP2B2-204; intron 5
ENST00000342354 ; ATP2B2-201; intron 5
ENST00000383800 ; ATP2B2-002; intron 5
ENST00000460129 ; ATP2B2-004; intron 5
ENST00000480680 ; ATP2B2-008; intron 5
ENST00000360273 ; ATP2B2-203; intron 5
ENST00000343816 ; ATP2B2-202; intron 5
ENST00000535386 ; ATP2B2-205; intron 5
ENST00000429937 ; ATP2B2-204; intron 5
ENST00000342354 ; ATP2B2-201; intron 5
ENST00000383800 ; ATP2B2-002; intron 5
ENST00000460129 ; ATP2B2-004; intron 5
ENST00000480680 ; ATP2B2-008; intron 5
ENST00000360273 ; ATP2B2-202; intron 5
ENST00000343816 ; ATP2B2-201; intron 5
ENST00000397077 ; ATP2B2-005; intron 7
ENST00000397077 ; ATP2B2-005; intron 7
ENST00000397077 ; ATP2B2-005; intron 7
Database links

Mature sequence hsa-miR-885-5p

Accession MIMAT0004947
Sequence

11 -  

uccauuacacuacccugccucu

 - 32

Get sequence
Deep sequencing 10 reads, 5 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-885-3p

Accession MIMAT0004948
Sequence

43 -  

aggcagcgggguguaguggaua

 - 64

Get sequence
Deep sequencing 25 reads, 4 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).