Stem-loop sequence hsa-mir-885

AccessionMI0005560 (change log)
Symbol HGNC:MIR885
DescriptionHomo sapiens miR-885 stem-loop
Gene family MIPF0000532; mir-885
Literature search

38 open access papers mention hsa-mir-885
(232 sentences)

Stem-loop
   --   ca    c           a  -         cu 
5'   ccg  cucu uccauuacacu cc cugccucuu  c
     |||  |||| ||||||||||| || |||||||||   
3'   ggc  gaga aggugaugugg gg gacggagag  c
   ug   ac    u           -  c         ua 
Get sequence
Deep sequencing
2465 reads, 4.49 reads per million, 89 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 10394489-10394562 [-]
sense
OTTHUMT00000276087 ; ATP2B2-003; intron 10
OTTHUMT00000276086 ; ATP2B2-002; intron 11
OTTHUMT00000276088 ; ATP2B2-004; intron 11
OTTHUMT00000250576 ; ATP2B2-001; intron 13
OTTHUMT00000276089 ; ATP2B2-005; intron 13
ENST00000452124 ; ATP2B2-003; intron 10
ENST00000383800 ; ATP2B2-002; intron 11
ENST00000460129 ; ATP2B2-004; intron 11
ENST00000352432 ; ATP2B2-001; intron 13
ENST00000397077 ; ATP2B2-005; intron 13
ENST00000343816 ; ATP2B2-201; intron 13
ENST00000360273 ; ATP2B2-202; intron 14
Database links

Mature sequence hsa-miR-885-5p

Accession MIMAT0004947
Sequence

11 - 

uccauuacacuacccugccucu

 - 32

Get sequence
Deep sequencing901 reads, 72 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-885-3p

Accession MIMAT0004948
Sequence

43 - 

aggcagcgggguguaguggaua

 - 64

Get sequence
Deep sequencing1559 reads, 30 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).