Stem-loop sequence hsa-mir-744

AccessionMI0005559
Symbol HGNC:MIR744
DescriptionHomo sapiens miR-744 stem-loop
Gene family MIPF0000431; mir-744
Stem-loop
   --     c     gc    c   -   u       gucuuacugaagguu 
5'   uuggg aaggu  gggg uag ggc aacagca               u
     ||||| |||||  |||| ||| ||| |||||||               c
3'   ggcuc uucca  cucc auc ccg uugucgu               c
   cu     a     -a    a   a   -       acacgcaccaaaggu 
Get sequence
Deep sequencing
55890 reads, 1.22e+03 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 12081899-12081996 [+]
intergenic
Database links

Mature sequence hsa-miR-744-5p

Accession MIMAT0004945
Previous IDshsa-miR-744
Sequence

11 - 

ugcggggcuagggcuaacagca

 - 32

Get sequence
Deep sequencing1655 reads, 62 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-744-3p

Accession MIMAT0004946
Previous IDshsa-miR-744*
Sequence

68 - 

cuguugccacuaaccucaaccu

 - 89

Get sequence
Deep sequencing54 reads, 21 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).