Stem-loop sequence mmu-mir-653

AccessionMI0005557 (change log)
Symbol MGI:Mir653
DescriptionMus musculus miR-653 stem-loop
Gene family MIPF0000435; mir-653
Literature search

2 open access papers mention mmu-mir-653
(2 sentences)

Stem-loop
   --       u              u     c     caa   c 
5'   cauucuu caguguugaaacaa cucua ugaac   gcu c
     ||||||| |||||||||||||| ||||| |||||   |||  
3'   gugagga guuaugacuuuguu gaggu acuug   cga a
   uc       c              u     c     -ag   a 
Get sequence
Deep sequencing
750 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 3721301-3721385 [-]
sense
OTTMUST00000091195 ; Calcr-004; intron 1
OTTMUST00000091196 ; Calcr-003; intron 4
OTTMUST00000091182 ; Calcr-005; intron 4
OTTMUST00000091197 ; Calcr-001; intron 4
ENSMUST00000171396 ; Calcr-004; intron 1
ENSMUST00000170266 ; Calcr-202; intron 2
ENSMUST00000168592 ; Calcr-201; intron 2
ENSMUST00000171613 ; Calcr-003; intron 4
ENSMUST00000115622 ; Calcr-005; intron 4
ENSMUST00000075644 ; Calcr-001; intron 4
Clustered miRNAs
< 10kb from mmu-mir-653
mmu-mir-489chr6: 3721897-3722003 [-]
mmu-mir-653chr6: 3721301-3721385 [-]
Database links

Mature sequence mmu-miR-653-5p

Accession MIMAT0004943
Previous IDsmmu-miR-653
Sequence

11 - 

guguugaaacaaucucuacug

 - 31

Get sequence
Deep sequencing698 reads, 33 experiments
Evidence experimental; RAKE [1], 454 [3], Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-653-3p

Accession MIMAT0017284
Previous IDsmmu-miR-653*
Sequence

51 - 

uucacuggaguuuguuucagu

 - 71

Get sequence
Deep sequencing50 reads, 16 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).