Stem-loop sequence mmu-mir-598

AccessionMI0005556 (change log)
Symbol MGI:Mir598
DescriptionMus musculus miR-598 stem-loop
Gene family MIPF0000393; mir-598
Literature search

1 open access papers mention mmu-mir-598
(1 sentences)

Stem-loop
   -- c     c           c      ---u  g    ga 
5'   g ugaug uggcggugaug cgaugg    gc agcu  a
     | ||||| ||||||||||| ||||||    || ||||  a
3'   c acuac auugcuacugc gcuacu    cg ucgg  a
   ua u     u           u      gcau  -    gu 
Get sequence
Deep sequencing
68542 reads, 80.6 reads per million, 98 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 63727189-63727267 [+]
sense
OTTMUST00000068922 ; Xkr6-001; intron 1
ENSMUST00000119973 ; Xkr6-001; intron 1
ENSMUST00000102094 ; Mir598-201; exon 1
Database links

Mature sequence mmu-miR-598-5p

Accession MIMAT0017283
Previous IDsmmu-miR-598*
Sequence

11 - 

gcggugaugccgauggugcgagc

 - 33

Get sequence
Deep sequencing40 reads, 15 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-598-3p

Accession MIMAT0004942
Previous IDsmmu-miR-598
Sequence

48 - 

uacgucaucgucgucaucguua

 - 69

Get sequence
Deep sequencing68501 reads, 98 experiments
Evidence experimental; RAKE [1], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).