Stem-loop sequence mmu-mir-511

Accession MI0005554
Symbol MGI:Mir511
Description Mus musculus miR-511 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
--   a    -  a  c        cu   c   g     a 
  gau ccca cc ug cuuuugcu  gca uca uaaau a
  ||| |||| || || ||||||||  ||| ||| |||||  
  cua gggu gg ac gaaaacga  ugu agu guuua u
ac   g    a  -  a        ug   a   -     a 
Get sequence
Deep sequencing
6195 reads, 85 experiments
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 14261003-14261081 [+]
sense
OTTMUST00000026697 ; Mrc1-001; intron 5
ENSMUST00000028045 ; Mrc1-001; intron 5
Database links

Mature sequence mmu-miR-511-5p

Accession MIMAT0004940
Previous IDs mmu-miR-511
Sequence

11 - 

augccuuuugcucugcacuca

 - 31

Get sequence
Deep sequencing 134 reads, 28 experiments
Evidence experimental; RAKE [1], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-511-3p

Accession MIMAT0017281
Sequence

49 - 

aauguguagcaaaagacaggau

 - 70

Get sequence
Deep sequencing 5840 reads, 70 experiments
Evidence experimental; Solexa [4]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).