Stem-loop sequence mmu-mir-511

Accession

MI0005554

Symbol

MGI:Mir511

Description

Mus musculus miR-511 stem-loop

Gene family

MIPF0000130; mir-506

Stem-loop

--   a    -  a  c        cu   c   g     a 
  gau ccca cc ug cuuuugcu  gca uca uaaau a
  ||| |||| || || ||||||||  ||| ||| |||||  
  cua gggu gg ac gaaaacga  ugu agu guuua u
ac   g    a  -  a        ug   a   -     a 

Deep sequencing

6195 reads, 85 experiments

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2].

Genome context

• Coordinates (GRCm38): chr2: 14261003-14261081 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000026697 ; Mrc1-001; intron 5

  ENSMUST00000028045 ; Mrc1-001; intron 5

Database links

• ENTREZGENE: 100124488;Mir511
• MGI: 3718546;Mir511

Mature sequence mmu-miR-511-5p

• Accession: MIMAT0004940
• Previous IDs: mmu-miR-511
• Sequence: 11 - augccuuuugcucugcacuca - 31
• Deep sequencing: 134 reads, 28 experiments
• Evidence: experimental; RAKE [1], Solexa [3-4]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-511-5p
  • MICRORNA.ORG:mmu-miR-511-5p
  • MIRDB:mmu-miR-511-5p
  • RNA22-MMU:mmu-miR-511-5p
  • TARGETSCAN-VERT:mmu-miR-511

Mature sequence mmu-miR-511-3p

• Accession: MIMAT0017281
• Sequence: 49 - aauguguagcaaaagacaggau - 70
• Deep sequencing: 5840 reads, 70 experiments
• Evidence: experimental; Solexa [4]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-511-3p
  • MIRDB:mmu-miR-511-3p
  • RNA22-MMU:mmu-miR-511-3p

References

1. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).