![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-877 |
|||||
Accession | MI0005553 (change log) | ||||
Symbol | MGI:Mir877 | ||||
Description | Mus musculus miR-877 stem-loop | ||||
Gene family | MIPF0000392; mir-877 | ||||
Literature search |
![]()
17 open access papers mention mmu-mir-877 | ||||
Stem-loop |
-gua au c c agguaggccuugcggg 5' gaggag gg g aggggacaca u |||||| || | |||||||||| 3' cuccuc cc c ucuccugugu c gacc -- u u acagguucccaggugu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-877-5p |
|
Accession | MIMAT0004861 |
Previous IDs | mmu-miR-877 |
Sequence |
1 - guagaggagauggcgcaggg - 20 |
Deep sequencing | 14640 reads, 100 experiments |
Evidence | experimental; cloned [1-2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-877-3p |
|
Accession | MIMAT0004862 |
Previous IDs | mmu-miR-877* |
Sequence |
63 - uguccucuucucccuccuccca - 84 |
Deep sequencing | 1225 reads, 86 experiments |
Evidence | experimental; cloned [1-2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17964270
"Mammalian mirtron genes"
Mol Cell. 28:328-336(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|