Stem-loop sequence mmu-mir-877

AccessionMI0005553 (change log)
Symbol MGI:Mir877
DescriptionMus musculus miR-877 stem-loop
Gene family MIPF0000392; mir-877
Stem-loop 
   -gua      au  c c          agguaggccuugcggg 
5'     gaggag  gg g aggggacaca                u
       ||||||  || | ||||||||||                 
3'     cuccuc  cc c ucuccugugu                c
   gacc      --  u u          acagguucccaggugu
Get sequence
Deep sequencing
10214 reads, 10.5 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 35960730-35960814 [-]
sense
OTTMUST00000096569 ; Abcf1-001; intron 12
ENSMUST00000043757 ; Abcf1-001; intron 12
Database links

Mature sequence mmu-miR-877-5p

Accession MIMAT0004861
Previous IDsmmu-miR-877
Sequence

1 -  

guagaggagauggcgcaggg

 - 20

Get sequence
Deep sequencing9672 reads, 74 experiments
Evidence experimental; cloned [1-2], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-877-3p

Accession MIMAT0004862
Previous IDsmmu-miR-877*
Sequence

63 -  

uguccucuucucccuccuccca

 - 84

Get sequence
Deep sequencing515 reads, 60 experiments
Evidence experimental; cloned [1-2], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).