Stem-loop sequence mmu-mir-208b

AccessionMI0005552 (change log)
Symbol MGI:Mir208b
DescriptionMus musculus miR-208b stem-loop
Gene family MIPF0000178; mir-208
Literature search

70 open access papers mention mmu-mir-208b
(198 sentences)

Stem-loop
   --c        g          c   cg        cu 
5'    cucucagg aagcuuuuug ucg  uuauguuu  c
      |||||||| |||||||||| |||  ||||||||  a
3'    gggagucu uuuggaaaac agc  aauauaag  u
   guc        g          a   ag        cc 
Get sequence
Deep sequencing
1835 reads, 7.32 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 54975700-54975776 [-]
sense
OTTMUST00000039449 ; Myh7-001; intron 31
ENSMUST00000102803 ; Myh7-001; intron 31
ENSMUST00000168485 ; Myh7-201; intron 31
Database links

Mature sequence mmu-miR-208b-5p

Accession MIMAT0017280
Previous IDsmmu-miR-208b*
Sequence

11 - 

aagcuuuuugcucgcguuaugu

 - 32

Get sequence
Deep sequencing18 reads, 9 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-208b-3p

Accession MIMAT0004939
Previous IDsmmu-miR-208b
Sequence

46 - 

auaagacgaacaaaagguuugu

 - 67

Get sequence
Deep sequencing1816 reads, 41 experiments
Evidence experimental; cloned [2], 454 [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).