Stem-loop sequence mmu-mir-875

AccessionMI0005551 (change log)
Symbol MGI:Mir875
DescriptionMus musculus miR-875 stem-loop
Gene family MIPF0000424; mir-875
Literature search

4 open access papers mention mmu-mir-875
(4 sentences)

Stem-loop
   ---  u    u  u   -       u  a       uuca 
5'    uc gugg ac aua ccucagu uu ucaggug    u
      || |||| || ||| ||||||| || |||||||    u
3'    ag cacu ug uau ggaguca aa aguccac    a
   acg  u    u  -   c       u  a       uaaa 
Get sequence
Deep sequencing
307 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 35660970-35661047 [-]
antisense
ENSMUST00000048646 ; Vps13b-201; intron 30
Clustered miRNAs
< 10kb from mmu-mir-875
mmu-mir-875chr15: 35660970-35661047 [-]
mmu-mir-599chr15: 35660831-35660918 [-]
Database links

Mature sequence mmu-miR-875-5p

Accession MIMAT0004937
Sequence

11 - 

uauaccucaguuuuaucaggug

 - 32

Get sequence
Deep sequencing232 reads, 22 experiments
Evidence experimental; RAKE [1], Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-875-3p

Accession MIMAT0004938
Sequence

46 - 

ccugaaaauacugaggcuaug

 - 66

Get sequence
Deep sequencing75 reads, 3 experiments
Evidence experimental; RAKE [1], Illumina [3]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).