Stem-loop sequence mmu-mir-873a

AccessionMI0005550 (change log)
Previous IDsmmu-mir-873
Symbol MGI:Mir873a
DescriptionMus musculus miR-873 stem-loop
Gene family MIPF0000390; mir-873
Literature search

7 open access papers mention mmu-mir-873a
(38 sentences)

Stem-loop
   --   u ca   g a         g        a  ga 
5'   gug g  uuu c ggaacuugu agucuccu uu  a
     ||| |  ||| | ||||||||| |||||||| ||  a
3'   cac c  aag g ccuugaaca ucagagga ag  a
   aa   c ac   g c         g        c  au 
Get sequence
Deep sequencing
6404 reads, 6.52 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 36668510-36668586 [-]
sense
OTTMUST00000014873 ; Lingo2-001; intron 2
OTTMUST00000014888 ; Lingo2-005; intron 2
ENSMUST00000108122 ; Lingo2-001; intron 2
ENSMUST00000124999 ; Lingo2-005; intron 2
Clustered miRNAs
< 10kb from mmu-mir-873a
mmu-mir-873bchr4: 36668510-36668586 [+]
mmu-mir-873achr4: 36668510-36668586 [-]
Database links

Mature sequence mmu-miR-873a-5p

Accession MIMAT0004936
Previous IDsmmu-miR-873;mmu-miR-873-5p
Sequence

11 - 

gcaggaacuugugagucuccu

 - 31

Get sequence
Deep sequencing4701 reads, 41 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-873a-3p

Accession MIMAT0017279
Previous IDsmmu-miR-873*;mmu-miR-873-3p
Sequence

47 - 

gagacugacaaguucccggga

 - 67

Get sequence
Deep sequencing1701 reads, 28 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).