Stem-loop sequence mmu-mir-878

AccessionMI0005548 (change log)
Symbol MGI:Mir878
DescriptionMus musculus miR-878 stem-loop
Gene family MIPF0000434; mir-878
Literature search

3 open access papers mention mmu-mir-878
(4 sentences)

Stem-loop
   --u  aa g           -   a     a a   guga 
5'    gc  u cuuuaucuagu ugg uguca g cac    a
      ||  | ||||||||||| ||| ||||| | |||    a
3'    cg  a gagauggguca acc acagu c gug    c
   acu  gg g           c   -     a -   aauu 
Get sequence
Deep sequencing
103662 reads, 959 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66801508-66801585 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-878
mmu-mir-871chrX: 66810428-66810504 [-]
mmu-mir-881chrX: 66801944-66802021 [-]
mmu-mir-878chrX: 66801508-66801585 [-]
mmu-mir-880chrX: 66800530-66800607 [-]
mmu-mir-463chrX: 66799223-66799297 [-]
mmu-mir-741chrX: 66796805-66796875 [-]
mmu-mir-471chrX: 66792595-66792661 [-]
Database links

Mature sequence mmu-miR-878-5p

Accession MIMAT0004932
Sequence

11 - 

uaucuaguuggaugucaagaca

 - 32

Get sequence
Deep sequencing84680 reads, 39 experiments
Evidence experimental; cloned [2], 454 [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-878-3p

Accession MIMAT0004933
Sequence

47 - 

gcaugacaccacacuggguaga

 - 68

Get sequence
Deep sequencing18980 reads, 44 experiments
Evidence experimental; cloned [2], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).