Stem-loop sequence mmu-mir-449b

AccessionMI0005547 (change log)
Symbol MGI:Mir449b
DescriptionMus musculus miR-449b stem-loop
Gene family MIPF0000133; mir-449
Literature search

48 open access papers mention mmu-mir-449b
(292 sentences)

Stem-loop
   ---   cuc    a     u  u   a c       guug  u 
5'    aga   gggu ggcag gu guu g uggcugc    gg c
      |||   |||| ||||| || ||| | |||||||    || a
3'    ucu   uuca ccguc ca cga c accgacg    cc g
   cgg   ucc    -     c  u   - -       ---a  g 
Get sequence
Deep sequencing
66245 reads, 527 reads per million, 95 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 113037419-113037498 [+]
sense
OTTMUST00000112400 ; Cdc20b-004; intron 2
OTTMUST00000112401 ; Cdc20b-002; intron 2
OTTMUST00000112402 ; Cdc20b-005; intron 2
OTTMUST00000112399 ; Cdc20b-001; intron 2
OTTMUST00000112403 ; Cdc20b-003; intron 2
ENSMUST00000180543 ; Cdc20b-004; intron 2
ENSMUST00000181568 ; Cdc20b-002; intron 2
ENSMUST00000109244 ; Cdc20b-005; intron 2
ENSMUST00000181117 ; Cdc20b-001; intron 2
ENSMUST00000181741 ; Cdc20b-003; intron 2
Clustered miRNAs
< 10kb from mmu-mir-449b
mmu-mir-449cchr13: 113035983-113036091 [+]
mmu-mir-449bchr13: 113037419-113037498 [+]
mmu-mir-449achr13: 113037534-113037624 [+]
Database links

Mature sequence mmu-miR-449b

Accession MIMAT0005447
Sequence

11 - 

aggcaguguuguuagcuggc

 - 30

Get sequence
Deep sequencing66224 reads, 93 experiments
Evidence by similarity; MI0003673
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).