Stem-loop sequence hsa-mir-190b

AccessionMI0005545 (change log)
Symbol HGNC:MIR190B
DescriptionHomo sapiens miR-190b stem-loop
Gene family MIPF0000076; mir-190
Literature search

49 open access papers mention hsa-mir-190b
(223 sentences)

Stem-loop
   -    u     -u               g     -   aa 
5'  ugcu cugug  gauauguuugauauu gguug uuu  u
    |||| |||||  ||||||||||||||| ||||| |||   
3'  acga gacau  uuauacaaacuguaa ucaac aag  u
   g    c     uc               a     c   ga 
Get sequence
Deep sequencing
5614 reads, 8.96 reads per million, 134 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 154193665-154193743 [-]
antisense
OTTHUMT00000087674 ; UBAP2L-002; intron 1
OTTHUMT00000087676 ; UBAP2L-004; intron 1
OTTHUMT00000087678 ; UBAP2L-006; intron 1
OTTHUMT00000087677 ; UBAP2L-005; intron 1
OTTHUMT00000087679 ; UBAP2L-007; intron 1
ENST00000343815 ; UBAP2L-002; intron 1
ENST00000441890 ; UBAP2L-004; intron 1
ENST00000412596 ; UBAP2L-006; intron 1
ENST00000368504 ; UBAP2L-005; intron 1
ENST00000437652 ; UBAP2L-007; intron 1
ENST00000271877 ; UBAP2L-201; intron 1
ENST00000428931 ; UBAP2L-202; intron 1
Database links

Mature sequence hsa-miR-190b-5p

Accession MIMAT0004929
Sequence

11 - 

ugauauguuugauauuggguug

 - 32

Get sequence
Deep sequencing5587 reads, 132 experiments
Evidence by similarity; MI0005478
Database links
Predicted targets

Mature sequence hsa-miR-190b-3p

Accession MIMAT0037332
Sequence

48 - 

acuaaaugucaaacauauucu

 - 68

Get sequence
Deep sequencing17 reads, 10 experiments
Evidence not experimental

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).