Stem-loop sequence hsa-mir-147b

AccessionMI0005544 (change log)
Symbol HGNC:MIR147B
DescriptionHomo sapiens miR-147b stem-loop
Gene family MIPF0000105; mir-147
Literature search

46 open access papers mention hsa-mir-147b
(350 sentences)

Stem-loop
   --  u    c   ug   a            aacuagauu      
5'   ua aaau uag  gaa cauuucugcaca         cugga 
     || |||| |||  ||| ||||||||||||         |||| c
3'   au uuua auc  cuu guaaaggcgugu         gacca 
   gg  u    c   gu   c            ---------      
Get sequence
Deep sequencing
2875 reads, 32.3 reads per million, 133 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 45433050-45433129 [+]
sense
OTTHUMT00000416255 ; DUOX1-002; exon 2
OTTHUMT00000416256 ; DUOX1-005; 3'UTR (exon 3)
OTTHUMT00000416254 ; DUOX1-003; 3'UTR (exon 12)
OTTHUMT00000416252 ; DUOX1-001; 3'UTR (exon 13)
OTTHUMT00000416251 ; DUOX1-006; 3'UTR (exon 14)
ENST00000558991 ; DUOX1-002; exon 2
ENST00000561166 ; DUOX1-005; 3'UTR (exon 3)
ENST00000561220 ; DUOX1-003; 3'UTR (exon 12)
ENST00000389037 ; DUOX1-001; 3'UTR (exon 13)
ENST00000321429 ; DUOX1-006; 3'UTR (exon 14)
Database links

Mature sequence hsa-miR-147b-5p

Accession MIMAT0037331
Sequence

12 - 

uggaaacauuucugcacaaacu

 - 33

Get sequence
Deep sequencing307 reads, 66 experiments
Evidence not experimental

Mature sequence hsa-miR-147b-3p

Accession MIMAT0004928
Sequence

49 - 

gugugcggaaaugcuucugcu

 - 69

Get sequence
Deep sequencing2558 reads, 131 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).