Stem-loop sequence hsa-mir-708

AccessionMI0005543
Symbol HGNC:MIR708
DescriptionHomo sapiens miR-708 stem-loop
Gene family MIPF0000397; mir-708
Stem-loop
   -aa        a           a     c  ggg  aa   ac 
5'    cugcccuc aggagcuuaca ucuag ug   gu  aug  u
      |||||||| ||||||||||| ||||| ||   ||  |||  u
3'    gacgggag ucuucgagugu agauc ac   ca  uac  g
   agg        a           c     a  --a  ag   ac 
Get sequence
Deep sequencing
2518 reads, 943 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr11: 79402022-79402109 [-]
intergenic
Database links

Mature sequence hsa-miR-708-5p

Accession MIMAT0004926
Previous IDshsa-miR-708
Sequence

11 - 

aaggagcuuacaaucuagcuggg

 - 33

Get sequence
Deep sequencing749 reads, 47 experiments
Evidence experimental; cloned [1-2]
Validated targets
Predicted targets

Mature sequence hsa-miR-708-3p

Accession MIMAT0004927
Previous IDshsa-miR-708*
Sequence

57 - 

caacuagacugugagcuucuag

 - 78

Get sequence
Deep sequencing156 reads, 38 experiments
Evidence experimental; cloned [1]
Validated targets
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).