Stem-loop sequence hsa-mir-876

AccessionMI0005542
Symbol HGNC:MIR876
DescriptionHomo sapiens miR-876 stem-loop
Gene family MIPF0000430; mir-876
Stem-loop
   u    ug         u                aucuaa  u 
5'  gaag  cuguggauu cuuugugaaucaccau      gc a
    ||||  ||||||||| ||||||||||||||||      ||  
3'  cuuc  gauacuuaa gaaacauuugguggug      ug a
   a    gu         u                -----g  u 
Get sequence
Deep sequencing
443 reads, 368 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 28863626-28863706 [-]
sense
ENST00000401147 ; MIR876-201; exon 1
Database links

Mature sequence hsa-miR-876-5p

Accession MIMAT0004924
Sequence

11 - 

uggauuucuuugugaaucacca

 - 32

Get sequence
Deep sequencing272 reads, 30 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence hsa-miR-876-3p

Accession MIMAT0004925
Sequence

50 - 

uggugguuuacaaaguaauuca

 - 71

Get sequence
Deep sequencing91 reads, 21 experiments
Evidence experimental; cloned [1]
Validated targets
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).