Stem-loop sequence hsa-mir-875

AccessionMI0005541
Symbol HGNC:MIR875
DescriptionHomo sapiens miR-875 stem-loop
Gene family MIPF0000424; mir-875
Stem-loop
   --      gu  uau        u  a       uucu 
5'   uuagug  ac   accucagu uu ucaggug    u
     ||||||  ||   |||||||| || |||||||     
3'   agucac  ug   uggaguca aa gguccac    a
   ca      uc  ugu        c  a       uaaa 
Get sequence
Deep sequencing
5 reads, 60.4 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr8: 99536786-99536861 [-]
sense
OTTHUMT00000379652 ; STK3-014; intron 1
OTTHUMT00000379635 ; STK3-001; intron 10
OTTHUMT00000379636 ; STK3-002; intron 12
ENST00000517832 ; STK3-014; intron 1
ENST00000419617 ; STK3-001; intron 10
ENST00000523601 ; STK3-002; intron 12
Clustered miRNAs
< 10kb from hsa-mir-875
hsa-mir-875chr8: 99536786-99536861 [-]
hsa-mir-599chr8: 99536636-99536730 [-]
Database links

Mature sequence hsa-miR-875-5p

Accession MIMAT0004922
Sequence

11 - 

uauaccucaguuuuaucaggug

 - 32

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence hsa-miR-875-3p

Accession MIMAT0004923
Sequence

45 - 

ccuggaaacacugagguugug

 - 65

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).