Stem-loop sequence hsa-mir-889

AccessionMI0005540 (change log)
Symbol HGNC:MIR889
DescriptionHomo sapiens miR-889 stem-loop
Gene family MIPF0000514; mir-889
Literature search

10 open access papers mention hsa-mir-889
(21 sentences)

Stem-loop
   --     u   g     c      uagua     -  uau 
5'   gugcu aaa aaugg uguccg     ugguc uc   a
     ||||| ||| ||||| ||||||     ||||| ||   u
3'   uauga uuu uuacc acaggc     auuag ag   u
   cc     u   g     a      -uaua     u  uau 
Get sequence
Deep sequencing
17419 reads, 26.4 reads per million, 121 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101047901-101047979 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-889
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
Database links

Mature sequence hsa-miR-889-5p

Accession MIMAT0026719
Sequence

11 - 

aauggcuguccguaguaugguc

 - 32

Get sequence
Deep sequencing144 reads, 25 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-889-3p

Accession MIMAT0004921
Sequence

49 - 

uuaauaucggacaaccauugu

 - 69

Get sequence
Deep sequencing17268 reads, 121 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).