Stem-loop sequence hsa-mir-541

AccessionMI0005539 (change log)
Symbol HGNC:MIR541
DescriptionHomo sapiens miR-541 stem-loop
Gene family MIPF0000213; mir-541
Stem-loop
   -   -u     aaa        c    g uc      caaa      
5'  acg  caggg   ggauucug uguc g  ccacuc    guuca 
    |||  |||||   |||||||| |||| |  ||||||    |||| c
3'  ugu  gucuc   ucuaagac acgg u  gguggg    uaaga 
   g   uc     agg        -    g --      ----      
Get sequence
Deep sequencing
27 reads, 0 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101064495-101064578 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-541
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-541-5p

Accession MIMAT0004919
Previous IDshsa-miR-541*
Sequence

10 - 

aaaggauucugcugucggucccacu

 - 34

Get sequence
Deep sequencing21 reads, 2 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-541-3p

Accession MIMAT0004920
Previous IDshsa-miR-541
Sequence

54 - 

uggugggcacagaaucuggacu

 - 75

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).